Review



i c glutamicum i 2256 strain  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 97
      Buy from Supplier

    Structured Review

    ATCC i c glutamicum i 2256 strain
    I C Glutamicum I 2256 Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 860 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/i+c+glutamicum+i+2256+strain/RBL-2H3/us11884951-302-16-20
    Average 97 stars, based on 860 article reviews
    i c glutamicum i 2256 strain - by Bioz Stars, 2026-10
    97/100 stars

    Images

    Related Articles

    Activity Assay:

    Article Title: Method for producing RNA
    Article Snippet: In another embodiment, the activity of a protein may also be reduced as compared with the C. glutamicum 2256 strain (ATCC 13869). .. In another embodiment, the activity of a protein may also be reduced as compared with the C. glutamicum 2256 strain (ATCC 13869). ..

    Article Title: Method for producing RNA
    Article Snippet: In another embodiment, the activity of a protein may also be reduced as compared with the C. glutamicum 2256 strain (ATCC 13869). .. In another embodiment, the activity of a protein may also be reduced as compared with the C. glutamicum 2256 strain (ATCC 13869). ..

    Disruption:

    Article Title: Method for producing RNA
    Article Snippet: <1> Acquisition of ribonuclease III gene-deficient strain of Corynebacterium glutamicum A disruption strain of a ribonuclease III (RNaseIII) homologue gene (hereinafter also referred to as “mc gene”) of the C. glutamicum 2256 strain (ATCC 13869 strain, hereinafter also referred to simply as “2256 strain”) was constructed in the following manner. .. <1> Acquisition of ribonuclease III gene-deficient strain of Corynebacterium glutamicum A disruption strain of a ribonuclease III (RNaseIII) homologue gene (hereinafter also referred to as “mc gene”) of the C. glutamicum 2256 strain (ATCC 13869 strain, hereinafter also referred to simply as “2256 strain”) was constructed in the following manner. ..

    Article Title: Method for producing RNA
    Article Snippet: <1> Acquisition of Ribonuclease III Gene-Deficient Strain of Corynebacterium glutamicum A disruption strain of a ribonuclease III (RNaseIII) homologue gene (hereinafter also referred to as “rnc gene”) of the C. glutamicum 2256 strain (ATCC 13869 strain, hereinafter also referred to simply as “2256 strain”) was constructed in the following manner. .. <1> Acquisition of Ribonuclease III Gene-Deficient Strain of Corynebacterium glutamicum A disruption strain of a ribonuclease III (RNaseIII) homologue gene (hereinafter also referred to as “rnc gene”) of the C. glutamicum 2256 strain (ATCC 13869 strain, hereinafter also referred to simply as “2256 strain”) was constructed in the following manner. ..

    Construct:

    Article Title: Method for producing RNA
    Article Snippet: <1> Acquisition of ribonuclease III gene-deficient strain of Corynebacterium glutamicum A disruption strain of a ribonuclease III (RNaseIII) homologue gene (hereinafter also referred to as “mc gene”) of the C. glutamicum 2256 strain (ATCC 13869 strain, hereinafter also referred to simply as “2256 strain”) was constructed in the following manner. .. <1> Acquisition of ribonuclease III gene-deficient strain of Corynebacterium glutamicum A disruption strain of a ribonuclease III (RNaseIII) homologue gene (hereinafter also referred to as “mc gene”) of the C. glutamicum 2256 strain (ATCC 13869 strain, hereinafter also referred to simply as “2256 strain”) was constructed in the following manner. ..

    Article Title: Method for producing RNA
    Article Snippet: <1> Acquisition of Ribonuclease III Gene-Deficient Strain of Corynebacterium glutamicum A disruption strain of a ribonuclease III (RNaseIII) homologue gene (hereinafter also referred to as “rnc gene”) of the C. glutamicum 2256 strain (ATCC 13869 strain, hereinafter also referred to simply as “2256 strain”) was constructed in the following manner. .. <1> Acquisition of Ribonuclease III Gene-Deficient Strain of Corynebacterium glutamicum A disruption strain of a ribonuclease III (RNaseIII) homologue gene (hereinafter also referred to as “rnc gene”) of the C. glutamicum 2256 strain (ATCC 13869 strain, hereinafter also referred to simply as “2256 strain”) was constructed in the following manner. ..

    other:

    Article Title: Method for producing l-amino acid by increasing fructose uptake
    Article Snippet: In another embodiment, the activity of a protein may also be increased as compared with the C. glutamicum ATCC 13032 strain.

    Article Title: Method for producing l-amino acid by increasing fructose uptake
    Article Snippet: In another embodiment, the activity of a protein may also be reduced as compared with the C. glutamicum ATCC 13032 strain.

    Sequencing:

    Article Title: Method for producing l-amino acid by increasing fructose uptake
    Article Snippet: .. TABLE 1 SEQ ID Primer NO Nucleotide Sequence (5′→3′) 1 1 CCAAGCTTGCATGCCATTTGCGCCTGCAA CGTAGGTTG 2 2 AACAGGAATGTTCCTTTCGAAAA 3 3 AGGAACATTCCTGTTATGACTTCAAATAT CCAAACCAGCG 4 4 TATAATCCTCCTTTAAGCATGTGATTCTT CCTTTGTC 5 5 GAATCACATGCTTAAAGGAGGATTATAAT GACTACCCCGATCGTTCTGAG 6 6 CCAAGCTTGCATGCCAGGAGGATTATAAT GACTACCCCGATCGTTCTGAG 7 7 CCAAGCTTGCATGCCCGGGGTGCTACGCG 8 8 CGGTACCCGGGGATCAGCACAGGACCGTT TGCCATTG pVK9 (KmR; US2006-0141588) pVK9-xfp (KmR; WO2006/016705) pVK9-PmsrA-fucP-frk (KmR; present application) pVS7 (SpcR; WO2013/069634) pVS7-xfp (SpcR; present application) C. glutamicum 2256ΔsucAΔldhA yggB*(WO2014/185430) C. glutamicum 2256ΔsucAΔldhA yggB*/pVK9/pVS7 (present application) C. glutamicum 2256ΔsucAΔldhA yggB*/pVK9-PmsrA-fucP-frk/pVS7 (present application) C. glutamicum 2256ΔsucAΔldhA yggB*/pVK9/pVS7-xfp (present application) C. glutamicum 2256ΔsucAΔldhA yggB*/pVK9-PmsrA-fucP-frk/pVS7-xfp (present application) (2) Construction of Plasmids and Strains PCR was carried out by using genomic DNA of the C. glutamicum 2256 strain (ATCC 13869) as the template, and primers 1 and 2, to amplify a DNA fragment containing an upstream region of the msrA gene of C. glutamicum (including a promoter region; 369 bp). .. TABLE 1 SEQ ID Primer NO Nucleotide Sequence (5′→3′) 1 1 CCAAGCTTGCATGCCATTTGCGCCTGCAA CGTAGGTTG 2 2 AACAGGAATGTTCCTTTCGAAAA 3 3 AGGAACATTCCTGTTATGACTTCAAATAT CCAAACCAGCG 4 4 TATAATCCTCCTTTAAGCATGTGATTCTT CCTTTGTC 5 5 GAATCACATGCTTAAAGGAGGATTATAAT GACTACCCCGATCGTTCTGAG 6 6 CCAAGCTTGCATGCCAGGAGGATTATAAT GACTACCCCGATCGTTCTGAG 7 7 CCAAGCTTGCATGCCCGGGGTGCTACGCG 8 8 CGGTACCCGGGGATCAGCACAGGACCGTT TGCCATTG pVK9 (KmR; US2006-0141588) pVK9-xfp (KmR; WO2006/016705) pVK9-PmsrA-fucP-frk (KmR; present application) pVS7 (SpcR; WO2013/069634) pVS7-xfp (SpcR; present application) C. glutamicum 2256ΔsucAΔldhA yggB*(WO2014/185430) C. glutamicum 2256ΔsucAΔldhA yggB*/pVK9/pVS7 (present application) C. glutamicum 2256ΔsucAΔldhA yggB*/pVK9-PmsrA-fucP-frk/pVS7 (present application) C. glutamicum 2256ΔsucAΔldhA yggB*/pVK9/pVS7-xfp (present application) C. glutamicum 2256ΔsucAΔldhA yggB*/pVK9-PmsrA-fucP-frk/pVS7-xfp (present application) (2) Construction of Plasmids and Strains PCR was carried out by using genomic DNA of the C. glutamicum 2256 strain (ATCC 13869) as the template, and primers 1 and 2, to amplify a DNA fragment containing an upstream region of the msrA gene of C. glutamicum (including a promoter region; 369 bp).

    Polymerase Chain Reaction:

    Article Title: Method for producing l-amino acid by increasing fructose uptake
    Article Snippet: .. TABLE 1 SEQ ID Primer NO Nucleotide Sequence (5′→3′) 1 1 CCAAGCTTGCATGCCATTTGCGCCTGCAA CGTAGGTTG 2 2 AACAGGAATGTTCCTTTCGAAAA 3 3 AGGAACATTCCTGTTATGACTTCAAATAT CCAAACCAGCG 4 4 TATAATCCTCCTTTAAGCATGTGATTCTT CCTTTGTC 5 5 GAATCACATGCTTAAAGGAGGATTATAAT GACTACCCCGATCGTTCTGAG 6 6 CCAAGCTTGCATGCCAGGAGGATTATAAT GACTACCCCGATCGTTCTGAG 7 7 CCAAGCTTGCATGCCCGGGGTGCTACGCG 8 8 CGGTACCCGGGGATCAGCACAGGACCGTT TGCCATTG pVK9 (KmR; US2006-0141588) pVK9-xfp (KmR; WO2006/016705) pVK9-PmsrA-fucP-frk (KmR; present application) pVS7 (SpcR; WO2013/069634) pVS7-xfp (SpcR; present application) C. glutamicum 2256ΔsucAΔldhA yggB*(WO2014/185430) C. glutamicum 2256ΔsucAΔldhA yggB*/pVK9/pVS7 (present application) C. glutamicum 2256ΔsucAΔldhA yggB*/pVK9-PmsrA-fucP-frk/pVS7 (present application) C. glutamicum 2256ΔsucAΔldhA yggB*/pVK9/pVS7-xfp (present application) C. glutamicum 2256ΔsucAΔldhA yggB*/pVK9-PmsrA-fucP-frk/pVS7-xfp (present application) (2) Construction of Plasmids and Strains PCR was carried out by using genomic DNA of the C. glutamicum 2256 strain (ATCC 13869) as the template, and primers 1 and 2, to amplify a DNA fragment containing an upstream region of the msrA gene of C. glutamicum (including a promoter region; 369 bp). .. TABLE 1 SEQ ID Primer NO Nucleotide Sequence (5′→3′) 1 1 CCAAGCTTGCATGCCATTTGCGCCTGCAA CGTAGGTTG 2 2 AACAGGAATGTTCCTTTCGAAAA 3 3 AGGAACATTCCTGTTATGACTTCAAATAT CCAAACCAGCG 4 4 TATAATCCTCCTTTAAGCATGTGATTCTT CCTTTGTC 5 5 GAATCACATGCTTAAAGGAGGATTATAAT GACTACCCCGATCGTTCTGAG 6 6 CCAAGCTTGCATGCCAGGAGGATTATAAT GACTACCCCGATCGTTCTGAG 7 7 CCAAGCTTGCATGCCCGGGGTGCTACGCG 8 8 CGGTACCCGGGGATCAGCACAGGACCGTT TGCCATTG pVK9 (KmR; US2006-0141588) pVK9-xfp (KmR; WO2006/016705) pVK9-PmsrA-fucP-frk (KmR; present application) pVS7 (SpcR; WO2013/069634) pVS7-xfp (SpcR; present application) C. glutamicum 2256ΔsucAΔldhA yggB*(WO2014/185430) C. glutamicum 2256ΔsucAΔldhA yggB*/pVK9/pVS7 (present application) C. glutamicum 2256ΔsucAΔldhA yggB*/pVK9-PmsrA-fucP-frk/pVS7 (present application) C. glutamicum 2256ΔsucAΔldhA yggB*/pVK9/pVS7-xfp (present application) C. glutamicum 2256ΔsucAΔldhA yggB*/pVK9-PmsrA-fucP-frk/pVS7-xfp (present application) (2) Construction of Plasmids and Strains PCR was carried out by using genomic DNA of the C. glutamicum 2256 strain (ATCC 13869) as the template, and primers 1 and 2, to amplify a DNA fragment containing an upstream region of the msrA gene of C. glutamicum (including a promoter region; 369 bp).

    Derivative Assay:

    Article Title: Method for producing l-amino acid by increasing fructose uptake
    Article Snippet: .. The 2256ΔsucAΔldhA yggB* strain is a glutamic acid-producing strain derived from the C. glutamicum 2256 strain (ATCC 13869). .. The 2256ΔsucAΔldhA yggB* strain is a glutamic acid-producing strain derived from the C. glutamicum 2256 strain (ATCC 13869).



    Similar Products

    i c glutamicum i 2256 strain  (ATCC)
    97
    ATCC i c glutamicum i 2256 strain
    I C Glutamicum I 2256 Strain, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/i+c+glutamicum+i+2256+strain/RBL-2H3/us11884951-302-16-20
    Average 97 stars, based on 1 article reviews
    i c glutamicum i 2256 strain - by Bioz Stars, 2026-10
    97/100 stars
    		  Buy from Supplier

    Image Search Results